Review



pet29b-based vectors  (Twist Bioscience)


Bioz Verified Symbol Twist Bioscience is a verified supplier
Bioz Manufacturer Symbol Twist Bioscience manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Twist Bioscience pet29b-based vectors
    Pet29b Based Vectors, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/pet+29b/pmc11551332__pnas__2410926121__sapp-12-6-12
    Average 90 stars, based on 1 article reviews
    pet29b-based vectors - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Emergence of binding and catalysis from a designed generalist binding protein
    Article Snippet: The designed FABLE proteins, with additional N-terminal His tag and TEV cleavage site, were subjected to codon optimization for E. Coli. using Integrated DNA Technologies (IDT) codon optimization tool. .. The optimized genes with additional sequences of (GTTTAACTTTAAGAAGGAGATATACAT) at 5’ and (CTCGAGTGAGATCCGGCTGCTAAC) at 3’ of gene were ordered as “clonal genes” from Twist Biosciences, which were assembled into pET29b vector digested with Nde1 and Xho1 using Gibbson assembly ( ). .. The plasmids were introduced into Escherichia coli BL21(DE3) cells (C2527H, New England Biolabs) via chemical transformation.



    Similar Products

    pet29b vector  (New England Biolabs)
    99
    New England Biolabs pet29b vector
    Pet29b Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/NdeI/bio_rxiv__2025__01__30__635804-346-10-25
    Average 99 stars, based on 1 article reviews
    pet29b vector - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    pet29b-based vectors  (Twist Bioscience)
    90
    Twist Bioscience pet29b-based vectors
    Pet29b Based Vectors, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/pet+29b/pmc11551332__pnas__2410926121__sapp-12-6-12
    Average 90 stars, based on 1 article reviews
    pet29b-based vectors - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pet29b vector  (Twist Bioscience)
    90
    Twist Bioscience pet29b vector
    Pet29b Vector, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/pet+29b/bio_rxiv__2025__01__30__635804-237-28-22
    Average 90 stars, based on 1 article reviews
    pet29b vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    esrta 4s 9 pet29b vector  (Addgene inc)
    92
    Addgene inc esrta 4s 9 pet29b vector
    Esrta 4s 9 Pet29b Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/eSrtA(4S-9)+pET29b+(Plasmid+%2375146)/pmc11561763-218-16-19
    Average 92 stars, based on 1 article reviews
    esrta 4s 9 pet29b vector - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    pet29b vector  (Millipore)
    90
    Millipore pet29b vector
    Pet29b Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/pet28a/pmc11374688-182-33-35
    Average 90 stars, based on 1 article reviews
    pet29b vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pet29b expression vectors  (Danaher Inc)
    86
    Danaher Inc pet29b expression vectors
    Pet29b Expression Vectors, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/pmc11213709-170-19-23
    Average 86 stars, based on 1 article reviews
    pet29b expression vectors - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    pet29b-ht vector  (Millipore)
    90
    Millipore pet29b-ht vector
    Pet29b Ht Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/pet28a/pmc10689081-111-15-46
    Average 90 stars, based on 1 article reviews
    pet29b-ht vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    synthetic genes in pet29b + e. coli expression vectors  (GenScript corporation)
    90
    GenScript corporation synthetic genes in pet29b + e. coli expression vectors
    Synthetic Genes In Pet29b + E. Coli Expression Vectors, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/cpass+sars+cov+2+neutralization+antibody+detection+kit/pm36316485-190-17-23
    Average 90 stars, based on 1 article reviews
    synthetic genes in pet29b + e. coli expression vectors - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pet29b(+) expression vector  (Millipore)
    90
    Millipore pet29b(+) expression vector
    Pet29b(+) Expression Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet29b+vector/pet28a/pmc10074150-787-30-31
    Average 90 stars, based on 1 article reviews
    pet29b(+) expression vector - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results